Incorrect annotation of exon/intron boundary deletion
Dieses Issue hat noch niemand übernommen.
Bewertung
- Schwierigkeit
- 4/5
- Geschätzter Aufwand
- 3-5 Tage
- Anfängerfreundlichkeit
- 35/100
- Issue-Typ
- Bug
- Klarheit
- Größtenteils klar
- Aktivitätsstatus
- Veraltet
- Tech-Stack
- r
- Bereich
- bioinformatics
Rechercherichtung
Reproduziere den Bericht mit VariantAnnotation_1.49.1, der zitierten AnnotationHub-Transkript-Datenbank, dem GRCh38-Genompaket, dem Transkript ENST00000378230 und der chr1-Deletion. Beginne mit predictCoding und untersuche, wie die Funktion die Grenze von Exon 16 und das angrenzende Intron behandelt. Erledigt ist die Aufgabe, wenn sich die gemeldeten Codons und die CDS-Position für diese Variante nicht mehr in das falsche Exon oder Intron erstrecken.
Vom Indexierungsmodell aus dem Issue-Text verfasst.
Beschreibung
Using:
VariantAnnotation_1.49.1txdb = AnnotationHub::AnnotationHub()[["AH100643"]](UCSC seq styles)genome = BSgenome.Hsapiens.NCBI.GRCh38::BSgenome.Hsapiens.NCBI.GRCh38(UCSC seq styles)
I've got the following variant:
chr1:3826659-3826710 (genomic)
"CGATTCTTTACACACCCCAGTTCTTTGTGCACCCCAATTCTTTACATACCCT" (ref) -> "C" (alt)
( ^ exon 16 end <--- )
This overlaps transcript ENST00000378230, which has the following exons:
seqnames ranges strand | exon_id exon_rank
<Rle> <IRanges> <Rle> | <character> <integer>
chr1 3829266-3829373 - | ENSE00001690217 15
chr1 3826708-3826744 - | ENSE00001730754 16
chr1 3826370-3826436 - | ENSE00001769704 17
so the deletion only partially affects exon 16, and then the intron after. The predictCoding function reports:
REFCODON: CAGGACATTCAAGGAGGGAAAGCAGCCCCTGCTGAAGCTCTGGGAATCCCGGAT (= QDIQGGKAAPAEALGIPD)
VARCODON: CGT (= R; GT from extending into the intron?)
CDSLOC: 2186-2188
The sequence of each exon listed above is:
15: GCACGGAGAAAAGCGGCTACAGAAGAAGCAGAAAAACAAAAGAAAGAAGAAATAAAAGCTTTACAAGGGCAGCTGGCAGCACTGAAAGAAATTCAGGCTGAAGTTCAG
16: GAAAAAGAAAGTGATGCTGTGAAGCCAAAGAATCAGG [AGG = revcomp of variant end]
^ refcodon start
17: ACATTCAAGGAGGGAAAGCAGCCCCTGCTGAAGCTCTGGGAATCCCGGATGAGCACTATCTAGATAA
refcodon end ^ (but this exon should not be altered)
So this looks like VariantAnnotation incorrectly extends the REFCODON from one exon to the next, while the VARCODON extens into the (deleted part of the) intron?
- Vorherrschende Sprache
- R
- Sterne
- 32
- Forks
- 21
- PR-Merge-Kennzahlen
- Keine gemergten PRs in 30 T.
Beitragsleitfaden
Für dieses Repository ist kein Beitragsleitfaden indexiert
Erste Schritte
- Lesen Sie das ganze Issue und danach den Beitragsleitfaden des Projekts.
- Schreiben Sie ins Issue, dass Sie es übernehmen — das erspart doppelte Arbeit.
- Forken Sie das Repository und arbeiten Sie in einem Branch.
- Öffnen Sie einen Pull Request, der die Issue-Nummer nennt.
Mehr aus Bioconductor/VariantAnnotation
-
refactor the package Offen
Schwierigkeit 5/5 Über eine Woche Anfängerfreundlichkeit 25/100
Bioconductor/VariantAnnotation#115 · 4 Kommentare ·
-
Bioconductor/VariantAnnotation#114 · 1 Reaktion · 2 zugewiesene Personen ·
-
Schwierigkeit 5/5 Über eine Woche Anfängerfreundlichkeit 35/100
Bioconductor/VariantAnnotation#113 · 2 Kommentare ·
-
Schwierigkeit 3/5 1-2 Tage Anfängerfreundlichkeit 35/100
-
Schwierigkeit 5/5 Über eine Woche Anfängerfreundlichkeit 30/100
Bioconductor/VariantAnnotation#88 · 2 Kommentare ·
Alle Issues in Bioconductor/VariantAnnotation
Ähnliche Issues
-
Affects Web App documentation PRIORITY LOW
Schwierigkeit 2/5 1-3 Stunden Anfängerfreundlichkeit 75/100
-
Schwierigkeit 2/5 1-3 Stunden Anfängerfreundlichkeit 75/100
-
Schwierigkeit 1/5 Unter einer Stunde Anfängerfreundlichkeit 80/100
hubverse-org/hubCI#36 ·
-
Schwierigkeit 1/5 Unter einer Stunde Anfängerfreundlichkeit 85/100
-
Release 1.4.0 Offen
Schwierigkeit 2/5 1-3 Stunden Anfängerfreundlichkeit 70/100
pharmaverse/pharmaverseadam#170 ·