EnhancementFrom Redminehelp wanted
Repository metrics
- Stars
- (3,452 stars)
- PR merge metrics
- (Avg merge 2d 14h) (6 merged PRs in 30d)
Description
Originally filed by Dr. Wim De Smet http://lmg.ugent.be/users/dr-wim-de-smet as part of RedMine issue 3074, https://redmine.open-bio.org/issues/3074
You can see this by running the EMBL scanner directly with debugging turned on:
$ python -c "from Bio.GenBank.Scanner import EmblScanner; import sys; print(next(EmblScanner(debug=2).parse_records(sys.stdin)))" < A04195.imgt
Found the start of a record:
ID A04195 IMGT/LIGM annotation : by annotators; RNA; SYN; 51 BP.
Found feature table
Ignoring EMBL header line:
DT 15-MAY-1995 (Rel. 2, arrived in LIGM-DB )
Ignoring EMBL header line:
DT 20-APR-1999 (Rel. 11, Last updated, Version 4)
Ignoring EMBL header line:
FH Key Location/Qualifiers
Found end of features
ID: A04195
Name: A04195
Description: Artificial Ig lambda-chain mRNA ; RNA; rearranged configuration; Ig
-Light-Lambda; regular.
Database cross-references: EMBL:A04195
Number of features: 2
/taxonomy=['other sequences', 'artificial sequences']
/references=[Reference(title=';', ...)]
/accessions=['A04195']
/molecule_type=RNA
/data_file_division=SYN
/keywords=['antigen receptor', 'Immunoglobulin superfamily (IgSF)', 'Immunoglobu
lin (IG)', 'IG-Light', 'IG-Light-Lambda', 'cDNA', 'rearranged']
/organism=synthetic construct
Seq('GATTGATCAATGCAGGCTGTTATGACTCAGGAATCTGCACTCACCACATCA', IUPACAmbiguousDNA())